0
Preliminary Communication |

Propagation of Human Spermatogonial Stem Cells In Vitro FREE

Hooman Sadri-Ardekani, MD; Sefika C. Mizrak, DVM, PhD; Saskia K. M. van Daalen, BSc; Cindy M. Korver, BSc; Hermien L. Roepers-Gajadien, BSc; Morteza Koruji, PhD; Suzanne Hovingh, MSc; Theo M. de Reijke, MD, PhD; Jean J.M.C.H. de la Rosette, MD, PhD; Fulco van der Veen, MD, PhD; Dirk G. de Rooij, PhD; Sjoerd Repping, PhD; Ans M. M. van Pelt, PhD
[+] Author Affiliations

Author Affiliations: Center for Reproductive Medicine, Department of Obstetrics and Gynaecology (Drs Sadri-Ardekani, Mizrak, Koruji, van der Veen, de Rooij, Repping, and van Pelt and Mss van Daalen, Korver, Roepers-Gajadien, and Hovingh) and Department of Urology (Drs de Reijke and de la Rosette), Academic Medical Center, University of Amsterdam, Amsterdam, the Netherlands; and Reproductive Biotechnology Research Center, Avicenna Research Institute, Tehran, Iran (Dr Sadri-Ardekani).


JAMA. 2009;302(19):2127-2134. doi:10.1001/jama.2009.1689.
Text Size: A A A
Published online

Context  Young boys treated with high-dose chemotherapy are often confronted with infertility once they reach adulthood. Cryopreserving testicular tissue before chemotherapy and autotransplantation of spermatogonial stem cells at a later stage could theoretically allow for restoration of fertility.

Objective  To establish in vitro propagation of human spermatogonial stem cells from small testicular biopsies to obtain an adequate number of cells for successful transplantation.

Design, Setting, and Participants  Study performed from April 2007 to July 2009 using testis material donated by 6 adult men who underwent orchidectomy as part of prostate cancer treatment. Testicular cells were isolated and cultured in supplemented StemPro medium; germline stem cell clusters that arose were subcultured on human placental laminin–coated dishes in the same medium. Presence of spermatogonia was determined by reverse transcriptase polymerase chain reaction and immunofluorescence for spermatogonial markers. To test for the presence of functional spermatogonial stem cells in culture, xenotransplantation to testes of immunodeficient mice was performed, and migrated human spermatogonial stem cells after transplantation were detected by COT-1 fluorescence in situ hybridization. The number of colonized spermatogonial stem cells transplanted at early and later points during culture were counted to determine propagation.

Main Outcome Measures  Propagation of spermatogonial stem cells over time.

Results  Testicular cells could be cultured and propagated up to 15 weeks. Germline stem cell clusters arose in the testicular cell cultures from all 6 men and could be subcultured and propagated up to 28 weeks. Expression of spermatogonial markers on both the RNA and protein level was maintained throughout the entire culture period. In 4 of 6 men, xenotransplantation to mice demonstrated the presence of functional spermatogonial stem cells, even after prolonged in vitro culture. Spermatogonial stem cell numbers increased 53-fold within 19 days in the testicular cell culture and increased 18 450-fold within 64 days in the germline stem cell subculture.

Conclusion  Long-term culture and propagation of human spermatogonial stem cells in vitro is achievable.

Figures in this Article

Treatment success in young boys with cancer has increased tremendously over recent years, allowing most of them to survive their cancer. Currently, 1 in 250 young adults (20-29 years) is a long-term survivor of childhood cancer.1 Given this success in pediatric oncology, long-term adverse effects of cancer treatment are of increasing importance. Infertility is a major long-term adverse effect, because there are no means to preserve fertility prior to treatment, in contrast to adult men, for whom ejaculated sperm can be cryopreserved.

The theoretical approach to overcome this problem is to store testicular tissue before chemotherapy and to propagate and autotransplant spermatogonial stem cells from this tissue after cancer survival. In 1994, spermatogonial stem cell transplantation was performed successfully for the first time in the mouse.2 Since then, successful autotransplantation of spermatogonial stem cells has been achieved in a wide range of species, including bovine, goat, and monkey.35 In addition, it has been shown that spermatogonial stem cells from various species,69 including human,10 can home to the basal membrane of seminiferous tubules of immunodeficient mice after transplantation, making it possible to functionally test spermatogonial stem cells in experimental preclinical settings in vitro.

Because small testicular biopsies do not contain sufficient spermatogonial stem cells to fully repopulate the testis after transplantation, in vitro propagation of human spermatogonial stem cells will be necessary to obtain an adequate amount of cells for successful transplantation. Such culture methods have been recently developed in animal model systems1114 but have thus far not been reported for human spermatogonial stem cells.

We report here on an in vitro culture system that allows for long-term culture and propagation of human spermatogonial stem cells.

Human Testis Material

Testis samples were donated after oral informed consent by 6 patients undergoing bilateral orchidectomy as part of prostate cancer treatment. According to Dutch law, ethics committee approval was not required, because anonymized tissue samples were used. None of these men had previously received chemotherapy or radiotherapy, and the morphology of the testes showed normal spermatogenesis in all cases.

The testes were cut into small pieces and cryopreserved in 8% dimethyl sulfoxide (Sigma-Aldrich, St Louis, Missouri) and 20% fetal calf serum (FCS) (Invitrogen, Carlsbad, California) in minimum essential medium (MEM) (Invitrogen) and stored at −196°C for later cell isolation and culture. The use of frozen-thawed material rather than fresh material most closely resembles anticipated future practice of spermatogonial stem cell autotransplantation. A small piece of tissue was fixed in 4% paraformaldehyde and embedded in paraffin for immunohistochemical testing.

Testicular Cell Isolation, Culture, and Cryopreservation

After thawing, testis tissue pieces weighing approximately 100 mg to 200 mg were enzymatically digested to prepare a cell suspension, as described previously.15 Testicular cells were collected and cultured overnight in uncoated dishes in supplemented MEM (1× MEM with 1 × nonessential amino acids, 40 μg/mL gentamicin, 15 mM 4-[2-hydroxyethyl]-1-piperazineethanesulfonic acid [HEPES], 0.12% sodium bicarbonate, 4 mM L-glutamine [all from Invitrogen], penicillin (100 IU/mL)–streptomycin (100 μg/mL)[Sigma-Aldrich]) containing 10% FCS at 37°C and 5% CO2.

After overnight incubation, floating cells were collected and cultured at a density of 10 000 to 20 000 cells/cm2 in uncoated dishes with supplemented StemPro-34 (Invitrogen) as described previously,14 with minor modifications. We added 0.5% penicillin-streptomycin (Invitrogen) and replaced mouse epidermal growth factor (EGF), rat glial cell line–derived neurotrophic factor (GDNF), and mouse leukemia inhibitory factor (LIF) with recombinant human EGF (20 ng/mL) (Sigma-Aldrich), recombinant human GDNF (10 ng/mL) (Sigma-Aldrich), and recombinant human LIF (10 ng/mL) (Chemicon International Inc, Temecula, California). The cells were cultured in Costar uncoated 6-well culture plates (Cole-Parmer, Vernon Hills, Illinois) at 37°C in a humidified atmosphere with 5% CO2 and were passaged with trypsin EDTA (0.25%) (Invitrogen) every 7 to 10 days at 80% to 90% confluency to 1 or several new dishes. Surplus cells were cryopreserved in 10% dimethyl sulfoxide and 20% FCS in MEM. In the case of overgrowth of flat cells with long extensions which were interpreted as somatic cells, only germ cells and round dividing cells were differentially passaged to fresh dishes by vigorous pipetting.

Germline stem cell clusters were subcultured on culture dishes coated with human placenta laminin (20 μg/mL) (Sigma-Aldrich) in supplemented StemPro-34. Embryonic stem cell–like colonies were subcultured as recently described.16

Immunohistochemistry and Immunofluorescence

Promyelocytic leukemia zinc finger protein (PLZF, also known as zinc finger and BTB domain containing 16 [ZBTB16]) is a well-known spermatogonial-specific marker in many species,17 although it has never been described for human spermatogonia. Specificity of PLZF for human spermatogonia was first determined by immunohistochemical testing on human testicular sections. After confirmation of the specificity of this marker, it was used to identify spermatogonia in our culture system by immunofluorescence.

Immunohistochemical staining of PLZF was performed on 5-μm human testis sections and 4% paraformaldehyde–fixed cultured cells in Laboratory-Tek chamber slides (Nalgene Nunc International Corp, Rochester, New York). Deparaffinated testis sections and fixed cultured cells were treated in 0.2% Triton-X-100 for 10 minutes. Antigen retrieval was performed in sodium citrate, pH 6.0 at 98°C, in sections. To inhibit endogenous peroxidase, samples were treated with 0.3% hydrogen peroxide in phosphate-buffered salt for 10 minutes. Nonspecific adhesion sites were blocked in 5% bovine serum albumin for 1 hour at room temperature. Then sections and cells were incubated with anti-PLZF (sc-28319; Santa Cruz Biotechnology, Santa Cruz, California) overnight at 4°C. Signal was visualized on sections by incubation with Powervision poly horseradish peroxidase conjugated anti-mouse/rabbit/rat (Immuno Vision Technologies, Burlingame, California) for 1 hour at room temperature, followed by 3,3′-diaminobenzidine (DAB) as a substrate and hematoxylin as counterstain.

Visualization of the PLZF signal on cultured cells was performed by successive incubation with biotinylated goat anti-mouse (1 hour at room temperature) and avidin-Cy3 (1 hour at room temperature), with 4′,6-diamidino-2-phenylindol (DAPI) as a nuclear counterstain. As negative controls, we used isotype mouse IgG instead of the primary antibody. Slides were examined using an Olympus BX41 bright field microscope (Olympus America Inc, Center Valley, Pennsylvania) or a Leica DMRA fluorescence microscope (Leica Microsystems Inc, Bannockburn, Illinois).

Gene Expression

To determine the presence of spermatogonia during the entire culture, the expression of spermatogonial genes1718 was studied. Total RNA from cultured testicular cells, subcultured germline stem cells, embryonic stem cell–like cells,and whole testis as a positive control was isolated using the RNeasy Mini Kit (QIAGEN, Valencia, California). For reverse transcriptase polymerase chain reaction (PCR), first-strand cDNA was synthesized with random hexamers and the Superscript II preamplification system (Invitrogen), and PCR was carried out with specific primers for PLZF (ZBTB16) (forward: GGTCGAGCTTCCTGATAACG; reverse: CCTGTATGTGAGCGCAGGT; product size, 396 base pairs [bp]), ITGA6 (integrinα6) (forward: TCATGGATCTGCAAATGGAA; reverse: GCGGGGTTAGCAGTATATTCA; product size, 300 bp), ITGB1 (integrinβ1) (forward: GTGGGTGGTGCACAAATTC; reverse: GGTCAATGGGATAGTCTTCAGC; product size, 300 bp) and TBP (Tata box binding protein) (forward: GTGACCCAGCAGCATCACTG; reverse: GTCATGGCACCCTGAGGG; product size, 224 bp) as a general marker.

PCR amplification was performed on cDNA (with reverse transcriptase) and on RNA (without reverse transcriptase) as follows: 3 minutes at 94°C followed by 35 cycles of 1 minute at 94°C, 1 minute at specific annealing temperature for each primer (PLZF, 55°C; ITGA6, 52°C; ITGB1, 55°C; and TBP, 59°C), 1 minute at 72°C, and a final elongation of 5 minutes at 72°C.

Xenotransplantation

To determine the presence of functional spermatogonial stem cells in our culture system, human testicular cells were transplanted into testes of recipient NMRI (Naval Medical Research Institute) nu/nu male mice. The procedures were approved and performed according to the regulations provided by the animal ethics committee of the Academic Medical Center of the University of Amsterdam, Amsterdam, the Netherlands. To destroy endogenous spermatogenesis, the recipient mice were given 38 to 40 mg/kg of busulfan intraperitoneally 6 weeks before donor cell transplantation. Frozen cultured human testis cells, originating from separate culture wells and from several passage numbers and several points during culture, were thawed and resuspended in MEM for transplantation, as described previously.19 Average cell viability of the cryopreserved samples was about 80%, as determined by trypan blue staining.

To identify colonization of human spermatogonial stem cells, recipient mouse testes were recovered 10 weeks after donor cell transplantation. Because most colonized human spermatogonial stem cells are expected to be single cells,10 we determined colonization in recipient mouse testes in serial sections, with the transplanted mouse testes fixed in 4% paraformaldehyde and embedded in paraffin. To identify colonized human spermatogonial stem cells, every fifth section was analyzed by human COT-1 DNA (the most common human-specific repetitive DNA sequences) fluorescence in situ hybridization.20

Fluorescence In Situ Hybridization

Human COT-1 DNA (Roche, Basel, Switzerland) was biotin labeled by nick translation and used as a probe to recognize human cells in mouse testis.20 Testis sections (5 μm) mounted on 3-aminopropyltriethoxysilane (TESPA)−coated slides were deparaffinated and subsequently pretreated before hybridization with RNase A in 2× sodium chloride/sodium citrate solution for 1 hour at 37°C, 100 μg/mL proteinase K in TES (50 mM Tris-HCl, 10 mM EDTA, 10 mM NaCl) for 5 minutes at room temperature, and postfixed in 0.4% formaldehyde for 5 minutes at 4°C. After denaturation of sections at 85°C for 6 minutes, sections were hybridized at 37°C overnight with 2-ng/μL probe in hybridization mix (60% formamide, 2× sodium chloride/sodium citrate solution, 0.02M sodium phosphate buffer). Sections were washed in 50% formamide in 2× sodium chloride/sodium citrate solution at 42°C, and signal was visualized by incubation in avidin–Cy3 (Jackson ImmunoResearch, Suffolk, United Kingdom) in TNB (0.1M Tris [Sigma], 0.15 M NaCl [Merck, Whitehouse Station, New Jersey], 0.02% Thimerosal [Sigma], 0.05% blocking reagent [Roche]) for 20 minutes at 37°C and counterstained with DAPI as nuclear staining. As negative control, we only used hybridization mix.

Every fifth slide of serial-sectioned recipient testis was examined using fluorescence microscopy. The final number of colonized spermatogonial stem cells in the whole transplanted testis was determined by multiplying the number of colonies found in every fifth section by 2.5, because the mean nuclear diameter of spermatogonial stem cells is 10 μm and the thickness of each section was 5 μm.

Isolated testicular cells contained spermatogonia as indicated by the expression of PLZF, a specific marker for undifferentiated spermatogonia, and ITGA6 and ITGB1, which are predominantly expressed by spermatogonia (Figure 1). When put into culture, a monolayer of flat somatic cells developed with round germ cells on top (Figure 2A). Cells could be passaged every 7 to 10 days. When somatic cells tended to overgrow the culture, differential passaging was performed.

Place holder to copy figure label and caption
Figure 1. Expression of Spermatogonial Markers by Isolated Human Testis Cells (Study Participant UMC0001)
Grahic Jump Location

Reverse transcriptase polymerase chain reaction for spermatogonial markers PLZF (promyelocytic leukemia zinc finger protein), ITGA6 (integrinα6), and ITGB1 (integrinβ1) on whole testis and isolated cells from human testis before culture from the same study participant. TBP (Tata box binding protein) was used as a reference marker. The second lane for each sample tested shows the negative (without reverse transcriptase) control.

Place holder to copy figure label and caption
Figure 2. Representative Germline Stem Cell (GSC) Clusters and Embryonic Stem Cell (ES)–like Colonies (Study Participant UMC0001)
Grahic Jump Location

A, Phase contrast image of cultured human testicular cells before formation of clusters. B, Differential interference contrast image of a GSC cluster and an ES–like colony. C, Representative reverse transcriptase polymerase chain reaction for spermatogonial markers PLZF (promyelocytic leukemia zinc finger protein), ITGA6 (integrinα6), and ITGB1 (integrinβ1) of 1 of at least 20 subcultured GSC clusters and ES-like colonies. TBP (Tata box binding protein) was used as a reference marker. The second lane for each sample tested shows the negative (without reverse transcriptase) control.

In the cultures from all 6 men, we observed the appearance of clusters of germline stem cells as well as embryonic stem cell–like colonies after a mean of 22.5 (SD, 7.9) days. The germline stem cell clusters presented as clumps of individually visible cells, while the colonies of embryonic stem cell–like cells were sharply edged and compact (Figure 2B). Germline stem cell clusters expressed PLZF, while embryonic stem cell–like colonies did not (Figure 2C). On subculture of the embryonic stem cell–like colonies, these cells were able to differentiate into cells from all 3 germ layers in vitro.16

Testicular cells could be propagated for up to 15 weeks and 7 passages. The cells could successfully be cryopreserved regardless of the time in culture, with a mean recovery rate of 80% (SD, 9%). Germline stem cell clusters formed between the second and eighth week in the testicular cell culture. After this period, germline stem cell clusters no longer appeared, and after 15 weeks of culture the flat, long somatic cells within the cell culture detached from the culture dish and no longer supported the germ cells.

When we observed that the culture system no longer supported spermatogonial stem cells after 15 weeks of culture in 3 men, we developed the subculture system and used it in the remaining 3 men. Under feeder cell–free conditions in laminin-coated culture dishes, we could extend the culture of germline stem cells up to 28 weeks and 15 passages, and germline stem cell clusters continued to arise up to 20 weeks of culture. The germline stem cell clusters appeared in testicular cell cultures as well as subcultures on laminin, while the embryonic stem cell–like colonies only appeared between the second and eighth week in the testicular cell culture and never in the subcultured germline stem cell clusters.

Reverse transcriptase PCR using PLZF, ITGA6, and ITGB1 (Figure 3) and immunofluorescence for PLZF confirmed the presence of spermatogonia throughout the entire culture period (Figure 4A). Spermatogonia-specific expression of PLZF in human testes was confirmed by immunohistochemical testing (Figure 4B).

Place holder to copy figure label and caption
Figure 3. Expression of Spermatogonial Markers in Long-term Cultured Testicular Cells and Subcultured Germline Stem Cell (GSC) Clusters
Grahic Jump Location

A, Reverse transcriptase polymerase chain reaction on long-term cultured testicular cells of all study participants. B, Representative reverse transcriptase polymerase chain reaction of some of the long-term subcultured GSC clusters of 3 study participants. ITGA6 indicates integrinα6; ITGB1, integrinβ1; PLZF, promyelocytic leukemia zinc finger protein. TBP (Tata box binding protein) was used as a reference marker. For both A and B, the second lane for each sample tested shows the negative (without reverse transcriptase) control.

Place holder to copy figure label and caption
Figure 4. PLZF Expression in Human Testis and Cultured Testicular Cells
Grahic Jump Location

A, PLZF (promyelocytic leukemia zinc finger protein) immunofluorescence of Cy3 (red) staining on subcultured germline stem cells from study participant URO0021 (cluster 4, passage 4) with 4′,6-diamidino-2-phenylindol (DAPI) (blue) as a nuclear stain. B, Specific immunohistochemical (3,3′-diaminobenzidine [DAB]) localization of PLZF (brown) in the nuclei of type A spermatogonia in human testicular section (study participant UMC0001) (counterstained with hematoxylin [blue]).

After xenotransplantation of cultured testicular cells to the mouse testes, human spermatogonial stem cells from 4 of 6 men were found at the basal membranes of the mouse seminiferous tubules. Xenotransplantation of subcultured germline stem cell clusters occurred in 1 of 2 men (Figure 5 and Table). Because a limited number of animals were allowed for xenotransplantation, we chose to xenotransplant cells from one of the subcultures of germline stem cell clusters at several points during culture rather than transplanting cultures from all 3 men.

Place holder to copy figure label and caption
Figure 5. Detection of Human Spermatogonial Cells After Stem Cell Transplantation to Immunodeficient Mouse Testis
Grahic Jump Location

Detection of human spermatogonial stem cells after transplantation to immunodeficient mouse testis using human COT-1 fluorescence in situ hybridization (FISH) Cy3 (red, left panel), nuclear counterstaining with 4′,6-diamidino-2-phenylindol (DAPI) (blue, middle panel) and merged images of COT-1 and DAPI (right panel). A, Adult testis control. COT-1 DNA FISH nuclear signal is present in all cells of adult human testis. B, Immunodeficient mouse testis 2 hours after transplantation. COT-1 FISH–positive human cells are detected in the lumen of the mouse seminiferous tubules. C, Immunodeficient mouse testis 10 weeks after transplantation. Homing of human spermatogonial stem cell from long-term subcultured germline stem cells to the basal membrane of the seminiferous epithelium of mouse testis. Insets are a higher magnification of the colonized human spermatogonial stem cell, indicated by arrowheads.

Table Grahic Jump LocationTable. Colonization of Cultured Human Spermatogonial Stem Cells After Transplantation in Immunodeficient Mice

Transplantation of cells from an early passage (passage 2; 28 days in culture) and a later passage (passage 5; 47 days in culture) of the testicular cell culture showed a 53-fold increase in the number of human spermatogonial stem cells within this time frame of 19 days (Table). Similarly, transplantation of subcultured germline stem cells from 77 days of culture (passage 7) and from 141 days of culture (passage 12) showed an 18 450-fold increase in human spermatogonial stem cells within this time frame of 64 days (Table).

This report outlines the first, to our knowledge, successful long-term culture and propagation of human spermatogonial stem cells. Our culture system allowed spermatogonial stem cells to increase in number by self-renewal in vitro. We used a culture medium specifically formulated to support the development of human hematopoietic stem cells but later used to culture mouse and hamster spermatogonial stem cells.12,14 The growth factors included in this medium, ie, GDNF, BFGF (basic fibroblast growth factor), EGF, and LIF, are able to promote animal spermatogonial stem cell survival and proliferation.2123

In contrast to most animal studies,1214 we used residual testicular somatic cells in the cell suspension rather than mouse embryonic fibroblasts as feeder cells, because these somatic cells are capable of supporting mouse spermatogonial stem cells in culture.2425 Importantly, the use of supporting feeder cells originating from the patient's own testicular tissue will facilitate future clinical application, because this modification avoids the use of animal products.

The presence of human spermatogonial stem cells after long-term culture was demonstrated using xenotransplantation to mouse seminiferous tubules. Migration and colonization of spermatogonial stem cells to the basal membrane of the seminiferous tubule on transplantation is so far the only functional assay to prove the presence of spermatogonial stem cells in a testicular cell population. Here we describe the first colonization of mouse seminiferous tubules with human spermatogonial stem cells from long-term cultured testicular cells, indicating the stem cell capability of these cells even after long-term culture.

Our culture system allowed for a more than 18 000-fold increase in spermatogonial stem cell number. To estimate if the propagation of the spermatogonial stem cells we achieved is theoretically sufficient for future clinical application, we calculated that with a biopsy size of 0.2 mL from a prepubertal testis, the number of spermatogonial stem cells within this small sample needs to be increased 65-fold to colonize an adult testis of approximately 13 mL.26 From studies of transplantation of autologous animal spermatogonial stem cells, we know that the efficiency of colonization is between 5% and 12%.2731 Assuming that the efficiency with human cells is 5%, at least a 1300-fold increase in spermatogonial stem cells is needed for sufficient transplantation. This means that the more than 18 000-fold increase in human spermatogonial stem cells in our culture system would be quite sufficient.

In this study we cultured adult human testicular cells instead of prepubertal testicular cells. Although culture of testicular cells from prepubertal boys remains to be tested, culture systems similar to that described here have been used successfully to propagate spermatogonial stem cells from prepubertal animals, including mouse,14,32 bovine,11 rat,13 and hamster.12

Some important issues have to be addressed before autotransplantation of human spermatogonial stem cells can safely be introduced into clinical practice. The most important issue is that in the case of biopsies from patients with nonsolid tumors, tumor cells must not be reintroduced when cultured spermatogonial stem cells are autotransplanted to the patient. Therefore, a reliable method of eliminating any remaining malignant cells before transplantation in the case of nonsolid tumors needs to be developed.3334 In addition, the embryonic stem cell–like cells that spontaneously arise in testicular cell cultures may theoretically lead to tumor formation, but previous reports have shown that human testis-derived embryonic stem cell–like cells are unable to form extensive teratomas when injected in immunodeficient mice.16,3537 Moreover, we never observed intratesticular tumors or teratomas in any of the 15 recipient mice after transplantation, suggesting that propagated human spermatogonial stem cells in this long-term culture system remained completely committed to the germ line lineage.

In conclusion, these results show that long-term culture and propagation of human spermatogonial stem cells in vitro is achievable.

Corresponding Author: Ans M. M. van Pelt, PhD, Center for Reproductive Medicine (F2-131-2), Academic Medical Center, Meibergdreef 9, 1105 AZ Amsterdam, the Netherlands (a.m.vanpelt@amc.uva.nl).

Author Contributions: Dr van Pelt had full access to all of the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis.

Study concept and design: Sadri-Ardekani, Mizrak, van der Veen, de Rooij, Repping, van Pelt.

Acquisition of data: Sadri-Ardekani, van Daalen, Korver, Roepers-Gajadien, Koruji, de Reijke, de la Rosette, van Pelt.

Analysis and interpretation of data: Sadri-Ardekani, Mizrak, van Daalen, Korver, Roepers-Gajadien, Hovingh, Repping, van Pelt.

Drafting of the manuscript: Sadri-Ardekani, van Daalen, Korver, Roepers-Gajadien, Koruji, Hovingh, Repping, van Pelt.

Criticalrevision of the manuscript for important intellectual content: Sadri-Ardekani, Mizrak, de Reijke, de la Rosette, van der Veen, de Rooij, Repping, van Pelt.

Statistical analysis: Sadri-Ardekani, Repping.

Obtained funding: van der Veen, de Rooij, Repping, van Pelt.

Administrative, technical, or material support: Mizrak, van Daalen, Korver, Roepers-Gajadien, Koruji, Hovingh, de Reijke, de la Rosette, van Pelt.

Study supervision: Mizrak, van der Veen, de Rooij, Repping, van Pelt.

Financial Disclosures: None reported.

Funding/Support: This study was supported by the Children Cancer-Free Foundation (KIKA).

Role of the Sponsors: KIKA had no role in the design or conduct of the study; the collection, management, analysis, or interpretation of the data; or the preparation, review, or approval of the manuscript.

Additional Contributions: We thank Tycho M. Lock, MD (Department of Urology, University Medical Center, Utrecht, the Netherlands), and Andreas Meissner, MD (Department of Urology, Academic Medical Center, Amsterdam, the Netherlands), for providing us with patient samples and Jan Stap and Ron Hoebe, PhD (Cell Biology Department, Academic Medical Center, Amsterdam, the Netherlands), for technical assistance in fluorescence imaging. None of these persons received any compensation for their contributions.

Blatt J. Pregnancy outcome in long-term survivors of childhood cancer.  Med Pediatr Oncol. 1999;33(1):29-33
PubMed   |  Link to Article
Brinster RL, Zimmermann JW. Spermatogenesis following male germ-cell transplantation.  Proc Natl Acad Sci U S A. 1994;91(24):11298-11302
PubMed   |  Link to Article
Schlatt S, Foppiani L, Rolf C, Weinbauer GF, Nieschlag E. Germ cell transplantation into X-irradiated monkey testes.  Hum Reprod. 2002;17(1):55-62
PubMed   |  Link to Article
Honaramooz A, Behboodi E, Blash S, Megee SO, Dobrinski I. Germ cell transplantation in goats.  Mol Reprod Dev. 2003;64(4):422-428
PubMed   |  Link to Article
Izadyar F, Den Ouden K, Stout TA,  et al.  Autologous and homologous transplantation of bovine spermatogonial stem cells.  Reproduction. 2003;126(6):765-774
PubMed   |  Link to Article
Nagano M, McCarrey JR, Brinster RL. Primate spermatogonial stem cells colonize mouse testes.  Biol Reprod. 2001;64(5):1409-1416
PubMed   |  Link to Article
Creemers LB, Meng X, den Ouden K,  et al.  Transplantation of germ cells from glial cell line-derived neurotrophic factor-overexpressing mice to host testes depleted of endogenous spermatogenesis by fractionated irradiation.  Biol Reprod. 2002;66(6):1579-1584
PubMed   |  Link to Article
Izadyar F, Spierenberg GT, Creemers LB, den Ouden K, de Rooij DG. Isolation and purification of type A spermatogonia from the bovine testis.  Reproduction. 2002;124(1):85-94
PubMed   |  Link to Article
van Pelt AM, Roepers-Gajadien HL, Gademan IS, Creemers LB, de Rooij DG, van Dissel-Emiliani FM. Establishment of cell lines with rat spermatogonial stem cell characteristics.  Endocrinology. 2002;143(5):1845-1850
PubMed   |  Link to Article
Nagano M, Patrizio P, Brinster RL. Long-term survival of human spermatogonial stem cells in mouse testes.  Fertil Steril. 2002;78(6):1225-1233
PubMed   |  Link to Article
Aponte PM, Soda T, Teerds KJ, Mizrak SC, van de Kant HJ, de Rooij DG. Propagation of bovine spermatogonial stem cells in vitro.  Reproduction. 2008;136(5):543-557
PubMed   |  Link to Article
Kanatsu-Shinohara M, Muneto T, Lee J,  et al.  Long-term culture of male germline stem cells from hamster testes.  Biol Reprod. 2008;78(4):611-617
PubMed   |  Link to Article
Hamra FK, Chapman KM, Nguyen DM, Williams-Stephens AA, Hammer RE, Garbers DL. Self renewal, expansion, and transfection of rat spermatogonial stem cells in culture.  Proc Natl Acad Sci U S A. 2005;102(48):17430-17435
PubMed   |  Link to Article
Kanatsu-Shinohara M, Ogonuki N, Inoue K,  et al.  Long-term proliferation in culture and germline transmission of mouse male germline stem cells.  Biol Reprod. 2003;69(2):612-616
PubMed   |  Link to Article
van Pelt AM, Morena AR, van Dissel-Emiliani FM,  et al.  Isolation of the synchronized A spermatogonia from adult vitamin A-deficient rat testes.  Biol Reprod. 1996;55(2):439-444
PubMed   |  Link to Article
Mizrak SC, Chikhovskaya JV, Sadri-Ardekani H,  et al.  Embryonic stem cell-like cells derived from adult human testis [published online ahead of print October 8, 2009].  Hum ReprodLink to Article
PubMed
Aponte PM, van Bragt MP, de Rooij DG, van Pelt AM. Spermatogonial stem cells: characteristics and experimental possibilities.  APMIS. 2005;113(11-12):727-742
PubMed   |  Link to Article
Ebata KT, Yeh JR, Zhang X, Nagano MC. The application of biomarkers of spermatogonial stem cells for restoring male fertility.  Dis Markers. 2008;24(4-5):267-276
PubMed
Avarbock MR, Brinster CJ, Brinster RL. Reconstitution of spermatogenesis from frozen spermatogonial stem cells.  Nat Med. 1996;2(6):693-696
PubMed   |  Link to Article
Sullivan GJ, Bridger JM, Cuthbert AP, Newbold RF, Bickmore WA, McStay B. Human acrocentric chromosomes with transcriptionally silent nucleolar organizer regions associate with nucleoli.  EMBO J. 2001;20(11):2867-2874
PubMed   |  Link to Article
Kanatsu-Shinohara M, Miki H, Inoue K,  et al.  Long-term culture of mouse male germline stem cells under serum-or feeder-free conditions.  Biol Reprod. 2005;72(4):985-991
PubMed   |  Link to Article
Kubota H, Avarbock MR, Brinster RL. Growth factors essential for self-renewal and expansion of mouse spermatogonial stem cells.  Proc Natl Acad Sci U S A. 2004;101(47):16489-16494
PubMed   |  Link to Article
Meng X, Lindahl M, Hyvonen ME,  et al.  Regulation of cell fate decision of undifferentiated spermatogonia by GDNF.  Science. 2000;287(5457):1489-1493
PubMed   |  Link to Article
Huang YH, Chin CC, Ho HN,  et al.  Pluripotency of mouse spermatogonial stem cells maintained by IGF-1-dependent pathway.  FASEB J. 2009;23(7):2076-2087
PubMed   |  Link to Article
Kim J, Seandel M, Falciatori I, Wen D, Rafii S. CD34+ testicular stromal cells support long-term expansion of embryonic and adult stem and progenitor cells.  Stem Cells. 2008;26(10):2516-2522
PubMed   |  Link to Article
Béres J, Papp G, Pazonyi I, Czeizel E. Testicular volume variations from 0 to 28 years of age.  Int Urol Nephrol. 1989;21(2):159-167
PubMed   |  Link to Article
Dobrinski I, Ogawa T, Avarbock MR, Brinster RL. Computer assisted image analysis to assess colonization of recipient seminiferous tubules by spermatogonial stem cells from transgenic donor mice.  Mol Reprod Dev. 1999;53(2):142-148
PubMed   |  Link to Article
Nagano M, Avarbock MR, Brinster RL. Pattern and kinetics of mouse donor spermatogonial stem cell colonization in recipient testes.  Biol Reprod. 1999;60(6):1429-1436
PubMed   |  Link to Article
Nagano MC. Homing efficiency and proliferation kinetics of male germ line stem cells following transplantation in mice.  Biol Reprod. 2003;69(2):701-707
PubMed   |  Link to Article
Orwig KE, Shinohara T, Avarbock MR, Brinster RL. Functional analysis of stem cells in the adult rat testis.  Biol Reprod. 2002;66(4):944-949
PubMed   |  Link to Article
Kubota H, Brinster RL. Technology insight: in vitro culture of spermatogonial stem cells and their potential therapeutic uses.  Nat Clin Pract Endocrinol Metab. 2006;2(2):99-108
PubMed   |  Link to Article
Kanatsu-Shinohara M, Ogonuki N, Iwano T,  et al.  Genetic and epigenetic properties of mouse male germline stem cells during long-term culture.  Development. 2005;132(18):4155-4163
PubMed   |  Link to Article
Geens M, Van de Velde H, De Block G, Goossens E, Van Steirteghem A, Tournaye H. The efficiency of magnetic-activated cell sorting and fluorescence-activated cell sorting in the decontamination of testicular cell suspensions in cancer patients.  Hum Reprod. 2007;22(3):733-742
PubMed   |  Link to Article
Fujita K, Tsujimura A, Miyagawa Y,  et al.  Isolation of germ cells from leukemia and lymphoma cells in a human in vitro model: potential clinical application for restoring human fertility after anticancer therapy.  Cancer Res. 2006;66(23):11166-11171
PubMed   |  Link to Article
Conrad S, Renninger M, Hennenlotter J,  et al.  Generation of pluripotent stem cells from adult human testis.  Nature. 2008;456(7220):344-349
PubMed   |  Link to Article
Kossack N, Meneses J, Shefi S,  et al.  Isolation and characterization of pluripotent human spermatogonial stem cell-derived cells.  Stem Cells. 2009;27(1):138-149
PubMed   |  Link to Article
Golestaneh N, Kokkinaki M, Pant D,  et al.  Pluripotent stem cells derived from adult human testes [published online ahead of print March 12, 2009].  Stem Cells Dev. 2009;Link to Article
PubMed

Figures

Place holder to copy figure label and caption
Figure 1. Expression of Spermatogonial Markers by Isolated Human Testis Cells (Study Participant UMC0001)
Grahic Jump Location

Reverse transcriptase polymerase chain reaction for spermatogonial markers PLZF (promyelocytic leukemia zinc finger protein), ITGA6 (integrinα6), and ITGB1 (integrinβ1) on whole testis and isolated cells from human testis before culture from the same study participant. TBP (Tata box binding protein) was used as a reference marker. The second lane for each sample tested shows the negative (without reverse transcriptase) control.

Place holder to copy figure label and caption
Figure 2. Representative Germline Stem Cell (GSC) Clusters and Embryonic Stem Cell (ES)–like Colonies (Study Participant UMC0001)
Grahic Jump Location

A, Phase contrast image of cultured human testicular cells before formation of clusters. B, Differential interference contrast image of a GSC cluster and an ES–like colony. C, Representative reverse transcriptase polymerase chain reaction for spermatogonial markers PLZF (promyelocytic leukemia zinc finger protein), ITGA6 (integrinα6), and ITGB1 (integrinβ1) of 1 of at least 20 subcultured GSC clusters and ES-like colonies. TBP (Tata box binding protein) was used as a reference marker. The second lane for each sample tested shows the negative (without reverse transcriptase) control.

Place holder to copy figure label and caption
Figure 3. Expression of Spermatogonial Markers in Long-term Cultured Testicular Cells and Subcultured Germline Stem Cell (GSC) Clusters
Grahic Jump Location

A, Reverse transcriptase polymerase chain reaction on long-term cultured testicular cells of all study participants. B, Representative reverse transcriptase polymerase chain reaction of some of the long-term subcultured GSC clusters of 3 study participants. ITGA6 indicates integrinα6; ITGB1, integrinβ1; PLZF, promyelocytic leukemia zinc finger protein. TBP (Tata box binding protein) was used as a reference marker. For both A and B, the second lane for each sample tested shows the negative (without reverse transcriptase) control.

Place holder to copy figure label and caption
Figure 4. PLZF Expression in Human Testis and Cultured Testicular Cells
Grahic Jump Location

A, PLZF (promyelocytic leukemia zinc finger protein) immunofluorescence of Cy3 (red) staining on subcultured germline stem cells from study participant URO0021 (cluster 4, passage 4) with 4′,6-diamidino-2-phenylindol (DAPI) (blue) as a nuclear stain. B, Specific immunohistochemical (3,3′-diaminobenzidine [DAB]) localization of PLZF (brown) in the nuclei of type A spermatogonia in human testicular section (study participant UMC0001) (counterstained with hematoxylin [blue]).

Place holder to copy figure label and caption
Figure 5. Detection of Human Spermatogonial Cells After Stem Cell Transplantation to Immunodeficient Mouse Testis
Grahic Jump Location

Detection of human spermatogonial stem cells after transplantation to immunodeficient mouse testis using human COT-1 fluorescence in situ hybridization (FISH) Cy3 (red, left panel), nuclear counterstaining with 4′,6-diamidino-2-phenylindol (DAPI) (blue, middle panel) and merged images of COT-1 and DAPI (right panel). A, Adult testis control. COT-1 DNA FISH nuclear signal is present in all cells of adult human testis. B, Immunodeficient mouse testis 2 hours after transplantation. COT-1 FISH–positive human cells are detected in the lumen of the mouse seminiferous tubules. C, Immunodeficient mouse testis 10 weeks after transplantation. Homing of human spermatogonial stem cell from long-term subcultured germline stem cells to the basal membrane of the seminiferous epithelium of mouse testis. Insets are a higher magnification of the colonized human spermatogonial stem cell, indicated by arrowheads.

Tables

Table Grahic Jump LocationTable. Colonization of Cultured Human Spermatogonial Stem Cells After Transplantation in Immunodeficient Mice

Interactive Graphics

Video

Country-Specific Mortality and Growth Failure in Infancy and Yound Children and Association With Material Stature

Use interactive graphics and maps to view and sort country-specific infant and early dhildhood mortality and growth failure data and their association with maternal

References

Blatt J. Pregnancy outcome in long-term survivors of childhood cancer.  Med Pediatr Oncol. 1999;33(1):29-33
PubMed   |  Link to Article
Brinster RL, Zimmermann JW. Spermatogenesis following male germ-cell transplantation.  Proc Natl Acad Sci U S A. 1994;91(24):11298-11302
PubMed   |  Link to Article
Schlatt S, Foppiani L, Rolf C, Weinbauer GF, Nieschlag E. Germ cell transplantation into X-irradiated monkey testes.  Hum Reprod. 2002;17(1):55-62
PubMed   |  Link to Article
Honaramooz A, Behboodi E, Blash S, Megee SO, Dobrinski I. Germ cell transplantation in goats.  Mol Reprod Dev. 2003;64(4):422-428
PubMed   |  Link to Article
Izadyar F, Den Ouden K, Stout TA,  et al.  Autologous and homologous transplantation of bovine spermatogonial stem cells.  Reproduction. 2003;126(6):765-774
PubMed   |  Link to Article
Nagano M, McCarrey JR, Brinster RL. Primate spermatogonial stem cells colonize mouse testes.  Biol Reprod. 2001;64(5):1409-1416
PubMed   |  Link to Article
Creemers LB, Meng X, den Ouden K,  et al.  Transplantation of germ cells from glial cell line-derived neurotrophic factor-overexpressing mice to host testes depleted of endogenous spermatogenesis by fractionated irradiation.  Biol Reprod. 2002;66(6):1579-1584
PubMed   |  Link to Article
Izadyar F, Spierenberg GT, Creemers LB, den Ouden K, de Rooij DG. Isolation and purification of type A spermatogonia from the bovine testis.  Reproduction. 2002;124(1):85-94
PubMed   |  Link to Article
van Pelt AM, Roepers-Gajadien HL, Gademan IS, Creemers LB, de Rooij DG, van Dissel-Emiliani FM. Establishment of cell lines with rat spermatogonial stem cell characteristics.  Endocrinology. 2002;143(5):1845-1850
PubMed   |  Link to Article
Nagano M, Patrizio P, Brinster RL. Long-term survival of human spermatogonial stem cells in mouse testes.  Fertil Steril. 2002;78(6):1225-1233
PubMed   |  Link to Article
Aponte PM, Soda T, Teerds KJ, Mizrak SC, van de Kant HJ, de Rooij DG. Propagation of bovine spermatogonial stem cells in vitro.  Reproduction. 2008;136(5):543-557
PubMed   |  Link to Article
Kanatsu-Shinohara M, Muneto T, Lee J,  et al.  Long-term culture of male germline stem cells from hamster testes.  Biol Reprod. 2008;78(4):611-617
PubMed   |  Link to Article
Hamra FK, Chapman KM, Nguyen DM, Williams-Stephens AA, Hammer RE, Garbers DL. Self renewal, expansion, and transfection of rat spermatogonial stem cells in culture.  Proc Natl Acad Sci U S A. 2005;102(48):17430-17435
PubMed   |  Link to Article
Kanatsu-Shinohara M, Ogonuki N, Inoue K,  et al.  Long-term proliferation in culture and germline transmission of mouse male germline stem cells.  Biol Reprod. 2003;69(2):612-616
PubMed   |  Link to Article
van Pelt AM, Morena AR, van Dissel-Emiliani FM,  et al.  Isolation of the synchronized A spermatogonia from adult vitamin A-deficient rat testes.  Biol Reprod. 1996;55(2):439-444
PubMed   |  Link to Article
Mizrak SC, Chikhovskaya JV, Sadri-Ardekani H,  et al.  Embryonic stem cell-like cells derived from adult human testis [published online ahead of print October 8, 2009].  Hum ReprodLink to Article
PubMed
Aponte PM, van Bragt MP, de Rooij DG, van Pelt AM. Spermatogonial stem cells: characteristics and experimental possibilities.  APMIS. 2005;113(11-12):727-742
PubMed   |  Link to Article
Ebata KT, Yeh JR, Zhang X, Nagano MC. The application of biomarkers of spermatogonial stem cells for restoring male fertility.  Dis Markers. 2008;24(4-5):267-276
PubMed
Avarbock MR, Brinster CJ, Brinster RL. Reconstitution of spermatogenesis from frozen spermatogonial stem cells.  Nat Med. 1996;2(6):693-696
PubMed   |  Link to Article
Sullivan GJ, Bridger JM, Cuthbert AP, Newbold RF, Bickmore WA, McStay B. Human acrocentric chromosomes with transcriptionally silent nucleolar organizer regions associate with nucleoli.  EMBO J. 2001;20(11):2867-2874
PubMed   |  Link to Article
Kanatsu-Shinohara M, Miki H, Inoue K,  et al.  Long-term culture of mouse male germline stem cells under serum-or feeder-free conditions.  Biol Reprod. 2005;72(4):985-991
PubMed   |  Link to Article
Kubota H, Avarbock MR, Brinster RL. Growth factors essential for self-renewal and expansion of mouse spermatogonial stem cells.  Proc Natl Acad Sci U S A. 2004;101(47):16489-16494
PubMed   |  Link to Article
Meng X, Lindahl M, Hyvonen ME,  et al.  Regulation of cell fate decision of undifferentiated spermatogonia by GDNF.  Science. 2000;287(5457):1489-1493
PubMed   |  Link to Article
Huang YH, Chin CC, Ho HN,  et al.  Pluripotency of mouse spermatogonial stem cells maintained by IGF-1-dependent pathway.  FASEB J. 2009;23(7):2076-2087
PubMed   |  Link to Article
Kim J, Seandel M, Falciatori I, Wen D, Rafii S. CD34+ testicular stromal cells support long-term expansion of embryonic and adult stem and progenitor cells.  Stem Cells. 2008;26(10):2516-2522
PubMed   |  Link to Article
Béres J, Papp G, Pazonyi I, Czeizel E. Testicular volume variations from 0 to 28 years of age.  Int Urol Nephrol. 1989;21(2):159-167
PubMed   |  Link to Article
Dobrinski I, Ogawa T, Avarbock MR, Brinster RL. Computer assisted image analysis to assess colonization of recipient seminiferous tubules by spermatogonial stem cells from transgenic donor mice.  Mol Reprod Dev. 1999;53(2):142-148
PubMed   |  Link to Article
Nagano M, Avarbock MR, Brinster RL. Pattern and kinetics of mouse donor spermatogonial stem cell colonization in recipient testes.  Biol Reprod. 1999;60(6):1429-1436
PubMed   |  Link to Article
Nagano MC. Homing efficiency and proliferation kinetics of male germ line stem cells following transplantation in mice.  Biol Reprod. 2003;69(2):701-707
PubMed   |  Link to Article
Orwig KE, Shinohara T, Avarbock MR, Brinster RL. Functional analysis of stem cells in the adult rat testis.  Biol Reprod. 2002;66(4):944-949
PubMed   |  Link to Article
Kubota H, Brinster RL. Technology insight: in vitro culture of spermatogonial stem cells and their potential therapeutic uses.  Nat Clin Pract Endocrinol Metab. 2006;2(2):99-108
PubMed   |  Link to Article
Kanatsu-Shinohara M, Ogonuki N, Iwano T,  et al.  Genetic and epigenetic properties of mouse male germline stem cells during long-term culture.  Development. 2005;132(18):4155-4163
PubMed   |  Link to Article
Geens M, Van de Velde H, De Block G, Goossens E, Van Steirteghem A, Tournaye H. The efficiency of magnetic-activated cell sorting and fluorescence-activated cell sorting in the decontamination of testicular cell suspensions in cancer patients.  Hum Reprod. 2007;22(3):733-742
PubMed   |  Link to Article
Fujita K, Tsujimura A, Miyagawa Y,  et al.  Isolation of germ cells from leukemia and lymphoma cells in a human in vitro model: potential clinical application for restoring human fertility after anticancer therapy.  Cancer Res. 2006;66(23):11166-11171
PubMed   |  Link to Article
Conrad S, Renninger M, Hennenlotter J,  et al.  Generation of pluripotent stem cells from adult human testis.  Nature. 2008;456(7220):344-349
PubMed   |  Link to Article
Kossack N, Meneses J, Shefi S,  et al.  Isolation and characterization of pluripotent human spermatogonial stem cell-derived cells.  Stem Cells. 2009;27(1):138-149
PubMed   |  Link to Article
Golestaneh N, Kokkinaki M, Pant D,  et al.  Pluripotent stem cells derived from adult human testes [published online ahead of print March 12, 2009].  Stem Cells Dev. 2009;Link to Article
PubMed
CME
Accreditation Information
The American Medical Association is accredited by the Accreditation Council for Continuing Medical Education to provide continuing medical education for physicians. The AMA designates this journal-based CME activity for a maximum of 1 AMA PRA Category 1 CreditTM per course. Physicians should claim only the credit commensurate with the extent of their participation in the activity. Physicians who complete the CME course and score at least 80% correct on the quiz are eligible for AMA PRA Category 1 CreditTM.
Note: You must get at least of the answers correct to pass this quiz.
You have not filled in all the answers to complete this quiz
The following questions were not answered:
Sorry, you have unsuccessfully completed this CME quiz with a score of
The following questions were not answered correctly:
Commitment to Change (optional):
Indicate what change(s) you will implement in your practice, if any, based on this CME course.
Your quiz results:
The filled radio buttons indicate your responses. The preferred responses are highlighted
For CME Course: A Proposed Model for Initial Assessment and Management of Acute Heart Failure Syndromes
Indicate what changes(s) you will implement in your practice, if any, based on this CME course.
NOTE:
Citing articles are presented as examples only. In non-demo SCM6 implementation, integration with CrossRef’s “Cited By” API will populate this tab (http://www.crossref.org/citedby.html).
Submit a Response

Some tools below are only available to our subscribers or users with an online account.

Related Content

Customize your page view by dragging & repositioning the boxes below.

Articles Related By Topic
Related Topics
PubMed Articles